Биология связи, том 6, Номер статьи: 646 (2023) Цитировать эту статью
896 Доступов
22 Альтметрика
Подробности о метриках
Химическая борьба с комарами-переносчиками болезней Aedes albopictus и Aedes aegypti является дорогостоящей, неустойчивой и все более неэффективной из-за распространения устойчивости к инсектицидам. Техника стерильных насекомых является ценной альтернативой, но ее возможности ограничены медленными, подверженными ошибкам и расточительными методами разделения полов. Здесь мы представляем четыре штамма генетического определения пола (по два для каждого вида Aedes), основанные на флуоресцентных маркерах, связанных с половыми локусами m и M, что позволяет изолировать трансгенных самцов. Кроме того, мы демонстрируем, как объединение этих штаммов по признаку пола позволяет получать нетрансгенных самцов. В учреждении массового разведения 100 000 личинок мужского пола первого возраста можно отсортировать менее чем за 1,5 часа с примерно 0,01–0,1% загрязнением самок на одной машине. Анализ экономической эффективности показал, что использование этих штаммов может привести к значительной экономии при создании и эксплуатации предприятия по массовому разведению. В целом, эти штаммы с генетическим определением пола должны позволить значительно расширить программы борьбы с этими важными переносчиками.
Aedes aegypti и Aedes albopictus являются инвазивными видами комаров, ответственными за передачу многих возбудителей, включая вирусы денге (DENV), чикунгуньи (CHIKV), Зика (ZIKV) и желтой лихорадки (YFV)1,2. Под воздействием изменения климата и мировой торговли оба переносчика быстро распространяются, и прогнозируется, что к 2050 году 49% населения мира будет подвергаться риску заболеваний, передаваемых Aedes, в отсутствие эффективных мер борьбы3,4.
Подавление популяций комаров с помощью генетического контроля является одной из наиболее эффективных, устойчивых и экологически чистых альтернатив использованию инсектицидов. Он основан на повторяющихся массовых выпусках некусающих самцов комаров – либо стерильных (метод стерильных насекомых, SIT5 и его производные, включая pgSIT6), инфицированных Wolbachia (метод несовместимых насекомых, IIT7,8,9), и тех, и других10,11 или несущие летальный трансген (Выпуск насекомых-носителей доминантно-летального, RIDL)12. Для всех этих мер необходим эффективный метод разделения полов. В настоящее время пол комаров Aedes определяют на основе естественного диморфизма размеров куколки с помощью сортировщика Хоха, который может быть полностью ручным13,14 или частично автоматизированным11. Этот метод, который требует однородного размера куколки и, следовательно, условий выращивания личинок с оптимизированной плотностью, страдает от уровня заражения самок от 0,8 до 1% и высокой дневной и индивидуальной изменчивости15. Примечательно, что недавно был описан многоступенчатый сортировщик куколок и взрослых особей, который позволил заразить 1,13 × 10-7% самок9. Однако эта система, как и все другие существующие методы, имеет тот недостаток, что сортировка происходит на поздней стадии и извлечение менее половины выращенных самцов14 означает, что >75% общего числа куколок выращиваются и кормятся напрасно.
У комаров Anopheles были описаны трансгенные генетические штаммы для определения пола (GSS), позволяющие автоматически разделять полы молодых личинок16,17,18,19. Флуоресцентные маркеры демонстрируют экспрессию, специфичную для мужчин, либо за счет использования специфичных для мужчин регуляторных последовательностей, либо за счет связывания маркеров с Y-хромосомой. Один из штаммов Anopheles coluzzii, определяющий пол, сцеплен с Х-хромосомой20, что делает самок более флуоресцентным, чем самцов. Разделение по полу осуществляется с помощью устройства параметрического анализатора и сортировщика сложных объектов (COPAS), которое действует как проточный цитометр и сортирует крупные частицы в соответствии с их флуоресценцией. Кроме того, в качестве альтернативы выпуску трансгенных самцов была предложена схема скрещивания, создающая нетрансгенные популяции, состоящие только из самцов, с использованием COPAS21. Для этой схемы требуется штамм, несущий маркер флуоресценции на Y-хромосоме, и другой штамм, несущий маркер флуоресценции на X-хромосоме. Скрещивание нетрансгенных (X-/X-) самок первой линии с трансгенными (X+/Y-) самцами второй линии приводит к получению потомства, состоящего из трансгенных (X+/X-) самок и нетрансгенных (X-/Y-) самок. −) самцы.
120 piggyBac random insertions (Fig. 1d). The best m-linked insertion line that we obtained showed a recombination frequency of 0.1%. Its transgenic cassette harboured a Cas9 transgene associated with a DsRed fluorescence marker and was flanked by lox sites. A Cas9 transgene being undesirable in a sexing strain, we excised it using CRE recombinase and replaced it with an eGFP transgene. This Ae. albopictus m-linked strain was termed Aal-m. Sequencing of the transposon’s flanking genomic sequence indicated that it had landed into a highly repeated region; hence, its exact genomic location could not be identified but matched several loci in 1q31 (see Methods and Supplementary Data 1). Both Ae. albopictus transgenic lines show a clear sex-separation pattern in COPAS analyses (Fig. 1c, d). All four lines were fluorescence-sorted and screened at each generation. In the Aaeg-M line, a single recombination event was visually recorded after 15 generations (>10,000 individuals screened in total). Consequently, we estimated that the Aaeg-M and Aaeg-m lines recombine at approximately 0.01%. In Aal-M, four recombinant individuals were observed in the tenth generation after successively screening a total of >50,000 individuals. These recombinations are likely to have arisen from a single event, suggesting that recombination is extremely rare in the Aal-M strain as well./p>$50,000 savings at 20 M males/week and above, Fig. 5e). In total, considering construction, equipment, diet and consumable costs, GSS is predicted to be the most economical option at all tested throughputs, while GSS-CS starts to be more economical compared to manual sorting of pupae from a 10 M males/week throughput (Fig. 5f). Moreover, the workload, the cost of which can only be estimated on a country-by-country basis, is reduced by 29–38% with GSS and 18–27% with GSS-CS (Fig. 5g). For all comparisons, including equipment cost, the most expensive option is the automated sorting of pupae, as the devices are expensive (e.g. $40k for the automated sorter from11, J. Bouyer) and the number of insects to be reared is high (Fig. 5b–g)./p>20,000 screened larvae), we later injected the repair donor plasmid (190 ng/µL) with 5 µM Scr7 and three plasmids expressing different gRNAs under the control of different AeU6 promoters (70 ng/µL each plasmid). This method gave significantly higher knock-in rates (25 GFP positive larvae out of about 4000 screened)./p>20,000 G1 larvae screened, a single transgenic male larva was found, raised to adulthood, and crossed to WT females. Its progeny was composed of 100% eGFP positive sons and 100% eGFP negative daughters, indicative of M linkage. We termed this Ae. aegypti M-linked strain Aaeg-M. Upon injection of 600 BgR9 eggs with the pX3 repair plasmid and a mixture of three plasmids expressing gRNAs (GTGGCATAGCGCCGTGTGGA[GGG], GTCTTAAATGAAAGAGGCG[AGG], GTATCATGCGTATTGCGAG[AGG], brackets indicate the PAM) under the control of three different U6 promoters (gRNA cloning vectors: Supplementary Data 4), 43 larvae with transient eGFP expression were recovered in G0. Resulting 20 males and 20 females were crossed en masse to adults of the opposite sex. 25 transgenic G1 larvae were obtained, 10 of which were males carrying an M-linked insertion, 4 were males carrying an m-linked insertion and 11 were females carrying an m-linked insertion. Proper insertion site in AAEL019619 was confirmed by PCR in all tested individuals, which revealed that in some of these mosquitoes the whole repair plasmid had integrated. From a single male devoid of the plasmid backbone, an Ae. aegypti m-linked strain named Aaeg-m was established and further characterized. Both Aaeg-M and Aaeg-m lines were backcrossed into a Brazilian (Bra) genetic background for 7 generations./p>700 individuals screened in each line until the sixth generation (Supplementary Table 3). Most other M-linked lines also showed 100% fluorescent males but contained additional, non-M-linked multiple insertions and were discarded. Based on line fitness and COPAS profiles, we selected a YFP line termed Aal-M for further work as an Ae. albopictus M-linked strain. Additional M-linked lines marked with OpIE2-GFP or Pub-DsRed showing no recombination to date, carrying a docking attP site for subsequent transgenesis, and representing additional GSSs are also being maintained to date but were not further characterized in detail./p>120 random piggyBac insertions. For this, we screened our existing collection of Ae. albopictus transgenic lines for m/M-linkage and constructed an additional library of piggyBac constructs expressing various fluorescence proteins (eGFP, mTurquoise2, YFP or DsRed) under the control of promoters showing distinct expression patterns (3xP3, OpIE2, Ae. aegypti PUb, Drosophila melanogaster actin5C). By performing multiplex injections of these piggyBac plasmids together, we obtained lines carrying up to six distinct insertions as indicated by their colours and patterns of fluorescence. Out of 40 independent founder transgenic individuals screened (most of which carrying multiple insertions), only two insertions appeared m-linked: one carried an OpIE2-mTurquoise2 marker gene with a recombination rate of about 3%, and the other, called m-albR9, carried a Cas9 transgene with a DsRed reporter gene and showed a recombination rate of 0.1%. We exploited the latter, in which transgenes are flanked by two lox sites adjacent to an attP docking site. We injected m-albR9 eggs with a plasmid encoding Cre recombinase to excise Cas9 and DsRed transgenes, as Cas9 is undesirable in a GSS. From successfully excised individuals, we established an m-linked attP docking line, mX1, carrying no further transgene. In a second step, an attB-containing plasmid carrying a PUb-eGFP marker cassette was integrated into the attP site. The m-linkage of this new strain was verified by crossing eGFP males to WT females and screening their offspring. The new Ae. albopictus m-linked line, named Aal-m was made hemi/homozygous and amplified./p>
Русский
English
Français
Deutsch
Español
Italiano
Português
日本語
한국어